kdpA Gene Page
Genbank name: kdpA
EcoGene name: kdpA
Divergent gene: ybfA
Species with an ortholog:
EC PA ST TF YP
EcoGene link: EG10513
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 12.39
Model logo: kdpA.1.model.LGO.gif
Sequence logo: kdpA.1.LGO.gif
Sequence Alignment: kdpA.1.ALGN
Solution location in genomic coordinates: 728246-728266 R
Solution sequence with flanking nucleotides: tgtaa TTTTACTACTCATCCGACCAC ttatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 728161-728181 R
Solution sequence with flanking nucleotides: taaat TAATACTAAACATTAGTTAAA tcatg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA ST TF
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.17
Model logo: kdpA.2.model.LGO.gif
Sequence logo: kdpA.2.LGO.gif
Sequence Alignment: kdpA.2.ALGN
Solution location in genomic coordinates: 727965-727980 R
Solution sequence with flanking nucleotides: ttatg CCCTGATCAATGCGGA ggcgt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST TF YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 12.03
Model logo: kdpA.3.model.LGO.gif
Sequence logo: kdpA.3.LGO.gif
Sequence Alignment: kdpA.3.ALGN
Solution location in genomic coordinates: 728129-728150 R
Solution sequence with flanking nucleotides: gcttt TGCCATTTTTATACTTTTTTTA caccc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page