kup Gene Page
Genbank name: kup
EcoGene name: trkD
Divergent gene: yieN
Species with an ortholog:
EC PA ST TF VC YP
EcoGene link: EG11541
Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 12.56
Model logo: kup.1.model.LGO.gif
Sequence logo: kup.1.LGO.gif
Sequence Alignment: kup.1.ALGN
Solution location in genomic coordinates: 3928746-3928768
Solution sequence with flanking nucleotides: a AGTTCTGCGTAAATTGCGAGTAT agacg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3928867-3928889
Solution sequence with flanking nucleotides: ccgtt AATCGTGCATACTGTGCGCTTTT ttgtg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 9.76
Model logo: kup.2.model.LGO.gif
Sequence logo: kup.2.LGO.gif
Sequence Alignment: kup.2.ALGN
Solution location in genomic coordinates: 3928891-3928908
Solution sequence with flanking nucleotides: ttttt TGTGGGCCAAGGGACTAA gcaca
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST TF VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 9.37
Model logo: kup.3.model.LGO.gif
Sequence logo: kup.3.LGO.gif
Sequence Alignment: kup.3.ALGN
Solution location in genomic coordinates: 3928755-3928778
Solution sequence with flanking nucleotides: ctgcg TAAATTGCGAGTATAGACGTTTCT tgctg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3928897-3928920
Solution sequence with flanking nucleotides: gtggg CCAAGGGACTAAGCACACATTTCA tattt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page