lacZ Gene Page

Genbank name: lacZ
EcoGene name: lacZ
Divergent gene:
Species with an ortholog: EC   VC   YP
EcoGene link: EG10527    Reported site,genomic coordinates and site type: DPInteract 365618:365639 crp
   Reported site,genomic coordinates and site type: DPInteract 365546:365567 crp
   Reported site,genomic coordinates and site type: DPInteract 365547:365567 lacI
   Reported site,genomic coordinates and site type: DPInteract 365639:365659 lacI
   Reported site,genomic coordinates and site type: DPInteract 365146:365166 lacI

Species that contributed to the solution: EC VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 10.06
Model logo: lacZ.1.model.LGO.gif
Sequence logo: lacZ.1.LGO.gif
Sequence Alignment: lacZ.1.ALGN
Solution location in genomic coordinates: 365617-365638 R
Solution sequence with flanking nucleotides: caatt AATGTGAGTTAGCTCACTCATT aggca
Number of overlapping basepairs with reported site: 21
Site type: crp

Species that contributed to the solution: EC VC
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.72
Model logo: lacZ.2.model.LGO.gif
Sequence logo: lacZ.2.LGO.gif
Sequence Alignment: lacZ.2.ALGN
Solution location in genomic coordinates: 365549-365565 R
Solution sequence with flanking nucleotides: tggaa TTGTGAGCGGATAACAA tttca
Number of overlapping basepairs with reported site: 17
Site type: crp lacI
Repeat: lacZ_lacI_IR Overlap: 17

Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 0.04
Model logo: lacZ.3.model.LGO.gif
Sequence logo: lacZ.3.LGO.gif
Sequence Alignment: lacZ.3.ALGN
Solution location in genomic coordinates: 365587-365608 R
Solution sequence with flanking nucleotides: caccc CAGGCTTTACACTTTATGCTTC cggct
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page