leuS Gene Page
Genbank name: leuS
EcoGene name: leuS
Divergent gene: ybeL
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10532
Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 22.16
Model logo: leuS.1.model.LGO.gif
Sequence logo: leuS.1.LGO.gif
Sequence Alignment: leuS.1.ALGN
Solution location in genomic coordinates: 674067-674085 R
Solution sequence with flanking nucleotides: acgtt TGGGCTATGCTATGCGGAT ctgaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 16.21
Model logo: leuS.2.model.LGO.gif
Sequence logo: leuS.2.LGO.gif
Sequence Alignment: leuS.2.ALGN
Solution location in genomic coordinates: 674067-674085 R
Solution sequence with flanking nucleotides: acgtt TGGGCTATGCTATGCGGAT ctgaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 674019-674037 R
Solution sequence with flanking nucleotides: tttgt AGCCGTATTGAAAACAGGA ccact
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 14.60
Model logo: leuS.3.model.LGO.gif
Sequence logo: leuS.3.LGO.gif
Sequence Alignment: leuS.3.ALGN
Solution location in genomic coordinates: 674175-674194 R
Solution sequence with flanking nucleotides: gttct TTGTTCCTTGCTTTGCTAAT acgcc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 674067-674086 R
Solution sequence with flanking nucleotides: gacgt TTGGGCTATGCTATGCGGAT ctgaa
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page