lgt Gene Page

Genbank name: lgt
EcoGene name: lgt
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG12128

Species that contributed to the solution: AA EC HI PA SP ST VC
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 9.65
Model logo: lgt.1.model.LGO.gif
Sequence logo: lgt.1.LGO.gif
Sequence Alignment: lgt.1.ALGN
Solution location in genomic coordinates: 2964172-2964195 R
Solution sequence with flanking nucleotides: tatac ATATCTTTTAACGGTATCCGGCAA ccagc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2964075-2964098 R
Solution sequence with flanking nucleotides: tcgct GTTCTCTTTCAGCGAAATAACAAG aactt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 9.07
Model logo: lgt.2.model.LGO.gif
Sequence logo: lgt.2.LGO.gif
Sequence Alignment: lgt.2.ALGN
Solution location in genomic coordinates: 2964140-2964155 R
Solution sequence with flanking nucleotides: ccctt GTGCTATTATTCGCAC ctttg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 7.59
Model logo: lgt.3.model.LGO.gif
Sequence logo: lgt.3.LGO.gif
Sequence Alignment: lgt.3.ALGN
Solution location in genomic coordinates: 2964105-2964128 R
Solution sequence with flanking nucleotides: agcgc CTGAAACCTGCGGCGCGCATTTCA atcgc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page