lipA Gene Page

Genbank name: lipA
EcoGene name: lipA
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG11306

Species that contributed to the solution: AA EC HI PA SP VC YP
Total number of sites in the solution: 13
Number of E. coli sites in the solution: 1
Map value: 29.74
Model logo: lipA.1.model.LGO.gif
Sequence logo: lipA.1.LGO.gif
Sequence Alignment: lipA.1.ALGN
Solution location in genomic coordinates: 659556-659576 R
Solution sequence with flanking nucleotides: cattt TCGCGACCGCTTTGGCTGCTT tcagg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 26.66
Model logo: lipA.2.model.LGO.gif
Sequence logo: lipA.2.LGO.gif
Sequence Alignment: lipA.2.ALGN
Solution location in genomic coordinates: 659577-659599 R
Solution sequence with flanking nucleotides: ggcac AATCCAACAACAATTTTACATTT tcgcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 659499-659521 R
Solution sequence with flanking nucleotides: tcgtt AATTCAAAAATAGTTGATAATTA caaca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 26.33
Model logo: lipA.3.model.LGO.gif
Sequence logo: lipA.3.LGO.gif
Sequence Alignment: lipA.3.ALGN
Solution location in genomic coordinates: 659448-659471 R
Solution sequence with flanking nucleotides: gcttt CCTTCGTAATTCGCAACTGGAACA cgcac
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page