livJ Gene Page

Genbank name: livJ
EcoGene name: livJ
Divergent gene:
Species with an ortholog: EC ST
EcoGene link: EG10539

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 20.75
Model logo: livJ.1.model.LGO.gif
Sequence logo: livJ.1.LGO.gif
Sequence Alignment: livJ.1.ALGN
Solution location in genomic coordinates: 3597378-3597399 R
Solution sequence with flanking nucleotides: tatgt TTTAGCAGAGTATGCTGCTAAA gcacg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: livJ_rpoH_IR Overlap: 22

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 6.58
Model logo: livJ.2.model.LGO.gif
Sequence logo: livJ.2.LGO.gif
Sequence Alignment: livJ.2.ALGN
Solution location in genomic coordinates: 3597436-3597459 R
Solution sequence with flanking nucleotides: tcccc ACGCAGATTGTTAATAAACTGTCA aaata
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3597403-3597426 R
Solution sequence with flanking nucleotides: agcta TTCCAATATCATAAAAATCGGGTA tgttt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.05
Model logo: livJ.3.model.LGO.gif
Sequence logo: livJ.3.LGO.gif
Sequence Alignment: livJ.3.ALGN
Solution location in genomic coordinates: 3597517-3597540 R
Solution sequence with flanking nucleotides: cagag AACCCTGGATGAGAGTCCGGGGTT tttgt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page