lldP Gene Page

Genbank name: lldP
EcoGene name: lldP
Divergent gene:
Species with an ortholog: EC PA SP ST
EcoGene link: EG11961 Reported site,genomic coordinates and site type: DPInteract 3774893:3774907 arcA

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 36.79
Model logo: lldP.1.model.LGO.gif
Sequence logo: lldP.1.LGO.gif
Sequence Alignment: lldP.1.ALGN
Solution location in genomic coordinates: 3774811-3774827
Solution sequence with flanking nucleotides: acaag AATTGGCCCTACCAATT cttcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3774937-3774953
Solution sequence with flanking nucleotides: aacac AATTGGCAGTGCCACTT ttaca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 9.46
Model logo: lldP.2.model.LGO.gif
Sequence logo: lldP.2.LGO.gif
Sequence Alignment: lldP.2.ALGN
Solution location in genomic coordinates: 3774915-3774935
Solution sequence with flanking nucleotides: ttcat TGTCATTATCCCTACACAACA caatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.58
Model logo: lldP.3.model.LGO.gif
Sequence logo: lldP.3.LGO.gif
Sequence Alignment: lldP.3.ALGN
Solution location in genomic coordinates: 3774888-3774910
Solution sequence with flanking nucleotides: tgcca ATACATAACATTTAGTTAACCAT tcatt
Number of overlapping basepairs with reported site: 15
Site type: arcA

Gene Index Page