lpdA Gene Page

Genbank name: lpdA
EcoGene name: lpd
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10543 Reported site,genomic coordinates and site type: DPInteract 127683:127697 arcA

Species that contributed to the solution: AA EC HI ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 20.97
Model logo: lpdA.1.model.LGO.gif
Sequence logo: lpdA.1.LGO.gif
Sequence Alignment: lpdA.1.ALGN
Solution location in genomic coordinates: 127625-127647
Solution sequence with flanking nucleotides: ctggt AATCTCATGAATGTATTGAGGTT attag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 127689-127711
Solution sequence with flanking nucleotides: taaaa ATTGTTAACAATTTTGTAAAATA ccgac
Number of overlapping basepairs with reported site: 9
Site type: arcA
Repeat: TERM4_IRU_IR Overlap: 21

Species that contributed to the solution: AA EC PA SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 18.09
Model logo: lpdA.2.model.LGO.gif
Sequence logo: lpdA.2.LGO.gif
Sequence Alignment: lpdA.2.ALGN
Solution location in genomic coordinates: 127593-127615
Solution sequence with flanking nucleotides: gtaaa AGAGCCGGCCCAACGGCCGGCTT ttttc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: TERM4 Overlap: 23

Species that contributed to the solution: EC ST TF YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 11.20
Model logo: lpdA.3.model.LGO.gif
Sequence logo: lpdA.3.LGO.gif
Sequence Alignment: lpdA.3.ALGN
Solution location in genomic coordinates: 127722-127738
Solution sequence with flanking nucleotides: ggata GAACGACCCGGTGGTGG ttagg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page