manA Gene Page

Genbank name: manA
EcoGene name: manA
Divergent gene: fumA
Species with an ortholog: AA EC ST VC YP
EcoGene link: EG10566

Species that contributed to the solution: AA EC ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 11.81
Model logo: manA.1.model.LGO.gif
Sequence logo: manA.1.LGO.gif
Sequence Alignment: manA.1.ALGN
Solution location in genomic coordinates: 1686447-1686470
Solution sequence with flanking nucleotides: gggtg TTCCGTTGCCCTGTTAAAAGCGAG taaca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1686484-1686507
Solution sequence with flanking nucleotides: tccta CACACTTTTTTAACAAAAACTGAG actag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 8.43
Model logo: manA.2.model.LGO.gif
Sequence logo: manA.2.LGO.gif
Sequence Alignment: manA.2.ALGN
Solution location in genomic coordinates: 1686581-1686598
Solution sequence with flanking nucleotides: tccac ATTAAAACAGGGATTGAT c
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.41
Model logo: manA.3.model.LGO.gif
Sequence logo: manA.3.LGO.gif
Sequence Alignment: manA.3.ALGN
Solution location in genomic coordinates: 1686508-1686523
Solution sequence with flanking nucleotides: ctgag ACTAGTACGACTTTTT gcggc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page