mglB Gene Page

Genbank name: mglB
EcoGene name: mglB
Divergent gene:
Species with an ortholog: EC   HI   ST   VC   YP   
EcoGene link: EG10593

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 28.12
Model logo: mglB.1.model.LGO.gif
Sequence logo: mglB.1.LGO.gif
Sequence Alignment: mglB.1.ALGN
Solution location in genomic coordinates: 2238616-2238639 R
Solution sequence with flanking nucleotides: ctttc AATCTGTGAGTGATTTCACAGTAT cttaa
Number of overlapping basepairs with reported site: 2
Site type: galR

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 19.05
Model logo: mglB.2.model.LGO.gif
Sequence logo: mglB.2.LGO.gif
Sequence Alignment: mglB.2.ALGN
Solution location in genomic coordinates: 2238610-2238630 R
Solution sequence with flanking nucleotides: tgtga GTGATTTCACAGTATCTTAAC aatgt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2238431-2238451 R
Solution sequence with flanking nucleotides: tcggc GTTCAGTAACACTTCATTAAC tctac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 9.27
Model logo: mglB.3.model.LGO.gif
Sequence logo: mglB.3.LGO.gif
Sequence Alignment: mglB.3.ALGN
Solution location in genomic coordinates: 2238571-2238586 R
Solution sequence with flanking nucleotides: gcacc GTTTTAACGTTGTAAC ccgta
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page