mlc Gene Page

Genbank name: mlc
EcoGene name: dgsA
Divergent gene:
Species with an ortholog: EC   ST   VC   YP   
EcoGene link: EG13156
   Reported site,genomic coordinates and site type: PMID:9484893 1666601:1666623 dgsA

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 19.34
Model logo: mlc.1.model.LGO.gif
Sequence logo: mlc.1.LGO.gif
Sequence Alignment: mlc.1.ALGN
Solution location in genomic coordinates: 1666632-1666651 R
Solution sequence with flanking nucleotides: acacg TATTGAAGTGCTTCACCATA gccta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1666602-1666621 R
Solution sequence with flanking nucleotides: cagat TATTTCGGAGCGCGAAAATA taggg
Number of overlapping basepairs with reported site: 20
Site type: dgsA

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 19.26
Model logo: mlc.2.model.LGO.gif
Sequence logo: mlc.2.LGO.gif
Sequence Alignment: mlc.2.ALGN
Solution location in genomic coordinates: 1666664-1666685 R
Solution sequence with flanking nucleotides: gctgt TAATCACATGCCTAAGTAAAAA tttga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1666601-1666622 R
Solution sequence with flanking nucleotides: acaga TTATTTCGGAGCGCGAAAATAT aggga
Number of overlapping basepairs with reported site: 22
Site type: dgsA

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.50
Model logo: mlc.3.model.LGO.gif
Sequence logo: mlc.3.LGO.gif
Sequence Alignment: mlc.3.ALGN
Solution location in genomic coordinates: 1666696-1666716 R
Solution sequence with flanking nucleotides: ggaaa TTTCAGCGAAAAAGCCCGAAA aatgt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page