modE Gene Page

Genbank name: modE
EcoGene name: modE
Divergent gene: ybhT
Species with an ortholog: EC HI PA SP ST YP
EcoGene link: EG13227

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 10.76
Model logo: modE.1.model.LGO.gif
Sequence logo: modE.1.LGO.gif
Sequence Alignment: modE.1.ALGN
Solution location in genomic coordinates: 793929-793951 R
Solution sequence with flanking nucleotides: taagc ACAGAAAAGCACTCCCCTTTTGT gcggt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 7.47
Model logo: modE.2.model.LGO.gif
Sequence logo: modE.2.LGO.gif
Sequence Alignment: modE.2.ALGN
Solution location in genomic coordinates: 793963-793986 R
Solution sequence with flanking nucleotides: aactc CAGATATAGTCATGAGACTATTCT aaccg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 4.25
Model logo: modE.3.model.LGO.gif
Sequence logo: modE.3.LGO.gif
Sequence Alignment: modE.3.ALGN
Solution location in genomic coordinates: 793958-793980 R
Solution sequence with flanking nucleotides: agata TAGTCATGAGACTATTCTAACCG ctaag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 793878-793900 R
Solution sequence with flanking nucleotides: gtttt CCGTCACAATAAGACTTTTGCCA ggaca
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page