msbB Gene Page

Genbank name: msbB
EcoGene name: msbB
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST VC YP
EcoGene link: EG10614

Species that contributed to the solution: AA EC PA SP ST VC
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 12.28
Model logo: msbB.1.model.LGO.gif
Sequence logo: msbB.1.LGO.gif
Sequence Alignment: msbB.1.ALGN
Solution location in genomic coordinates: 1938298-1938320 R
Solution sequence with flanking nucleotides: tcgca GCCGGTACGCAGTCAGTACCGGC ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: msbB_yebA_IR Overlap: 23
Solution location in genomic coordinates: 1938218-1938240 R
Solution sequence with flanking nucleotides: ttttt GCCTTATCCGAAACTGGAAAAGC
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 5.40
Model logo: msbB.2.model.LGO.gif
Sequence logo: msbB.2.LGO.gif
Sequence Alignment: msbB.2.ALGN
Solution location in genomic coordinates: 1938263-1938285 R
Solution sequence with flanking nucleotides: atttg GTGCGGGGCAAGTTGCGCCGCTA cacta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 2.57
Model logo: msbB.3.model.LGO.gif
Sequence logo: msbB.3.LGO.gif
Sequence Alignment: msbB.3.ALGN
Solution location in genomic coordinates: 1938244-1938259 R
Solution sequence with flanking nucleotides: tacac TATCACCAGATTGATT tttgc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page