mtr Gene Page

Genbank name: mtr
EcoGene name: mtr
Divergent gene:
Species with an ortholog: EC   HI   PA   SP   ST   YP
EcoGene link: EG10617    Reported site,genomic coordinates and site type: DPInteract 3303509:3303532 trpR
   Reported site,genomic coordinates and site type: DPInteract 3303567:3303588 tyrR
   Reported site,genomic coordinates and site type: DPInteract 3303597:3303618 tyrR

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 25.21
Model logo: mtr.1.model.LGO.gif
Sequence logo: mtr.1.LGO.gif
Sequence Alignment: mtr.1.ALGN
Solution location in genomic coordinates: 3303511-3303530 R
Solution sequence with flanking nucleotides: tcttt TGTACTCGTGTACTGGTACA gtgca
Number of overlapping basepairs with reported site: 20
Site type: trpR
Repeat: mtr_deaD_IR Overlap: 1

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.40
Model logo: mtr.2.model.LGO.gif
Sequence logo: mtr.2.LGO.gif
Sequence Alignment: mtr.2.ALGN
Solution location in genomic coordinates: 3303548-3303566 R
Solution sequence with flanking nucleotides: acagc CCCGATTTTTACCATCGGG gcttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: mtr_deaD_IR Overlap: 19

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.72
Model logo: mtr.3.model.LGO.gif
Sequence logo: mtr.3.LGO.gif
Sequence Alignment: mtr.3.ALGN
Solution location in genomic coordinates: 3303567-3303588 R
Solution sequence with flanking nucleotides: cacaa TCTGTAAAATAATATATACAGC cccga
Number of overlapping basepairs with reported site: 22
Site type: tyrR
Repeat: mtr_deaD_IR Overlap: 17

Gene Index Page