murA Gene Page
Genbank name: murA
EcoGene name: murA
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG11358
Species that contributed to the solution: AA EC ST TF YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 11.39
Model logo: murA.1.model.LGO.gif
Sequence logo: murA.1.LGO.gif
Sequence Alignment: murA.1.ALGN
Solution location in genomic coordinates: 3334167-3334189 R
Solution sequence with flanking nucleotides: tga GCTATGGGCGATTCGCCGGTAGC ggata
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3334143-3334165 R
Solution sequence with flanking nucleotides: tagcg GATATGAATTGTTAACTGAGAAC aaact
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 7.16
Model logo: murA.2.model.LGO.gif
Sequence logo: murA.2.LGO.gif
Sequence Alignment: murA.2.ALGN
Solution location in genomic coordinates: 3334172-3334191 R
Solution sequence with flanking nucleotides: t GAGCTATGGGCGATTCGCCG gtagc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3334148-3334167 R
Solution sequence with flanking nucleotides: ggtag CGGATATGAATTGTTAACTG agaac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 6.00
Model logo: murA.3.model.LGO.gif
Sequence logo: murA.3.LGO.gif
Sequence Alignment: murA.3.ALGN
Solution location in genomic coordinates: 3334162-3334177 R
Solution sequence with flanking nucleotides: gcgat TCGCCGGTAGCGGATA tgaat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page