nagD Gene Page

Genbank name: nagD
EcoGene name: nagD
Divergent gene:
Species with an ortholog: EC   SP   ST   YP   
EcoGene link: EG10634

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.75
Model logo: nagD.1.model.LGO.gif
Sequence logo: nagD.1.LGO.gif
Sequence Alignment: nagD.1.ALGN
Solution location in genomic coordinates: 699551-699567 R
Solution sequence with flanking nucleotides: gttgt CAATATTCTGGGTAGTC c
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.78
Model logo: nagD.2.model.LGO.gif
Sequence logo: nagD.2.LGO.gif
Sequence Alignment: nagD.2.ALGN
Solution location in genomic coordinates: 699576-699597 R
Solution sequence with flanking nucleotides: ta ATGTGCTTTTATAGTGGCGCTT attgt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page