ndh Gene Page

Genbank name: ndh
EcoGene name: ndh
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10649
   Reported site,genomic coordinates and site type: DPInteract 1165154:1165175 fnr
   Reported site,genomic coordinates and site type: DPInteract 1165110:1165131 fnr
   Reported site,genomic coordinates and site type: PMID:9308170 1165230:1165256 ihf
   Reported site,genomic coordinates and site type: PMID:9308170 1165191:1165217 ihf
   Reported site,genomic coordinates and site type: PMID:9308170 1165138:1165168 ihf
   Reported site,genomic coordinates and site type: PMID:8809757 1165074:1165103 fis
   Reported site,genomic coordinates and site type: PMID:8809757 1165132:1165153 fis
   Reported site,genomic coordinates and site type: PMID:8809757 1165253:1165277 fis

Species that contributed to the solution: AA EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 31.55
Model logo: ndh.1.model.LGO.gif
Sequence logo: ndh.1.LGO.gif
Sequence Alignment: ndh.1.ALGN
Solution location in genomic coordinates: 1165234-1165257
Solution sequence with flanking nucleotides: tgctg TAACCTGTTGTTAATTAAGAGCTA tgtta
Number of overlapping basepairs with reported site: 23
Site type: ihf fis
Repeat: REP102b_ndh_IR     Overlap: 24
Solution location in genomic coordinates: 1165264-1165287
Solution sequence with flanking nucleotides: gttaa TAACCATTAATTAACAATTGGTTA ataaa
Number of overlapping basepairs with reported site: 14
Site type: fis
Repeat: REP102b_ndh_IR     Overlap: 24

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 22.78
Model logo: ndh.2.model.LGO.gif
Sequence logo: ndh.2.LGO.gif
Sequence Alignment: ndh.2.ALGN
Solution location in genomic coordinates: 1165154-1165175
Solution sequence with flanking nucleotides: caaca AAACTTGATTAACATCAATTTT ggtat
Number of overlapping basepairs with reported site: 22
Site type: fnr ihf

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 21.23
Model logo: ndh.3.model.LGO.gif
Sequence logo: ndh.3.LGO.gif
Sequence Alignment: ndh.3.ALGN
Solution location in genomic coordinates: 1165145-1165167
Solution sequence with flanking nucleotides: tcttt TCAGCAACAAAACTTGATTAACA tcaat
Number of overlapping basepairs with reported site: 23
Site type: fnr ihf fis
Solution location in genomic coordinates: 1165268-1165290
Solution sequence with flanking nucleotides: ataac CATTAATTAACAATTGGTTAATA aattt
Number of overlapping basepairs with reported site: 10
Site type: fis
Repeat: REP102b_ndh_IR     Overlap: 20


Gene Index Page