nlpC Gene Page

Genbank name: nlpC
EcoGene name: nlpC
Divergent gene:
Species with an ortholog: EC   HI   SP   ST   YP   
EcoGene link: EG11133

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 13.00
Model logo: nlpC.1.model.LGO.gif
Sequence logo: nlpC.1.LGO.gif
Sequence Alignment: nlpC.1.ALGN
Solution location in genomic coordinates: 1790774-1790797 R
Solution sequence with flanking nucleotides: acgac GCTAAATTAATGCAAGAATAAAAA acaga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 9.30
Model logo: nlpC.2.model.LGO.gif
Sequence logo: nlpC.2.LGO.gif
Sequence Alignment: nlpC.2.ALGN
Solution location in genomic coordinates: 1790798-1790820 R
Solution sequence with flanking nucleotides: agtat CTTGAAAATCGGGTAATTACGAC gctaa
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page