nrdD Gene Page

Genbank name: nrdD
EcoGene name: nrdD
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   VC   YP   
EcoGene link: EG11417

Species that contributed to the solution: AA EC HI PA SP ST VC YP
Total number of sites in the solution: 15
Number of E. coli sites in the solution: 2
Map value: 68.33
Model logo: nrdD.1.model.LGO.gif
Sequence logo: nrdD.1.LGO.gif
Sequence Alignment: nrdD.1.ALGN
Solution location in genomic coordinates: 4460424-4460445 R
Solution sequence with flanking nucleotides: gatgc AAAGCACTATATATAGACTTTA aaatg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4460393-4460414 R
Solution sequence with flanking nucleotides: gcgtc CCAACCCAATATGTTGTATTAA tcgac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 23.73
Model logo: nrdD.2.model.LGO.gif
Sequence logo: nrdD.2.LGO.gif
Sequence Alignment: nrdD.2.ALGN
Solution location in genomic coordinates: 4460468-4460485 R
Solution sequence with flanking nucleotides: tttta CTTTGAGCTACATCAAAA aaagc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 7.33
Model logo: nrdD.3.model.LGO.gif
Sequence logo: nrdD.3.LGO.gif
Sequence Alignment: nrdD.3.ALGN
Solution location in genomic coordinates: 4460518-4460540 R
Solution sequence with flanking nucleotides: aattc ATTAAAAAATTTACATATCGCTG tagcg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page