nrfE Gene Page

Genbank name: nrfE
EcoGene name: nrfE
Divergent gene:
Species with an ortholog: EC   PA   SP   ST   
EcoGene link: EG11948

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 13.61
Model logo: nrfE.1.model.LGO.gif
Sequence logo: nrfE.1.LGO.gif
Sequence Alignment: nrfE.1.ALGN
Solution location in genomic coordinates: 4289046-4289064
Solution sequence with flanking nucleotides: tcctt CCTGAAGTCGGTTTTCTGG cgttg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 11.14
Model logo: nrfE.2.model.LGO.gif
Sequence logo: nrfE.2.LGO.gif
Sequence Alignment: nrfE.2.ALGN
Solution location in genomic coordinates: 4289068-4289088
Solution sequence with flanking nucleotides: ggcgt TGTTGTTAAGTCTCGGGGTCA ac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 6.85
Model logo: nrfE.3.model.LGO.gif
Sequence logo: nrfE.3.LGO.gif
Sequence Alignment: nrfE.3.ALGN
Solution location in genomic coordinates: 4289031-4289052
Solution sequence with flanking nucleotides: ggttt CTGGACGTATTCCTTCCTGAAG tcggt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4289069-4289090
Solution sequence with flanking nucleotides: gcgtt GTTGTTAAGTCTCGGGGTCAAC
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page