oxyR Gene Page
Genbank name: oxyR
EcoGene name: oxyR
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST VC YP
EcoGene link: EG10681
Reported site,genomic coordinates and site type: DPInteract 4156010:4156048 oxyR
Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 44.79
Model logo: oxyR.1.model.LGO.gif
Sequence logo: oxyR.1.LGO.gif
Sequence Alignment: oxyR.1.ALGN
Solution location in genomic coordinates: 4156002-4156025
Solution sequence with flanking nucleotides: gcttg ATAGGGATAATCGTTCATTGCTAT tctac
Number of overlapping basepairs with reported site: 16
Site type: oxyR
Solution location in genomic coordinates: 4156033-4156056
Solution sequence with flanking nucleotides: tacct ATCGCCATGAACTATCGTGGCGAT ggagg
Number of overlapping basepairs with reported site: 16
Site type: oxyR
Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 24.15
Model logo: oxyR.2.model.LGO.gif
Sequence logo: oxyR.2.LGO.gif
Sequence Alignment: oxyR.2.ALGN
Solution location in genomic coordinates: 4155899-4155922
Solution sequence with flanking nucleotides: gttgg CTTTAGTTATTCGAGTTGAGAAAC tctcg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 18.92
Model logo: oxyR.3.model.LGO.gif
Sequence logo: oxyR.3.LGO.gif
Sequence Alignment: oxyR.3.ALGN
Solution location in genomic coordinates: 4155845-4155868
Solution sequence with flanking nucleotides: ccggg CTTTTTTATGGCAAAAAAAAGCGG atcct
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page