pdhR Gene Page

Genbank name: pdhR
EcoGene name: pdhR
Divergent gene: aroP
Species with an ortholog: EC   PA   SP   ST   VC   YP   
EcoGene link: EG11088
   Reported site,genomic coordinates and site type: DPInteract 121953:121969 pdhR
   Reported site,genomic coordinates and site type: DPInteract 122044:122060 pdhR

Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 78.94
Model logo: pdhR.1.model.LGO.gif
Sequence logo: pdhR.1.LGO.gif
Sequence Alignment: pdhR.1.ALGN
Solution location in genomic coordinates: 122044-122060
Solution sequence with flanking nucleotides: catga AATTGGTAAGACCAATT gactt
Number of overlapping basepairs with reported site: 17
Site type: pdhR

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 19.36
Model logo: pdhR.2.model.LGO.gif
Sequence logo: pdhR.2.LGO.gif
Sequence Alignment: pdhR.2.ALGN
Solution location in genomic coordinates: 121794-121809
Solution sequence with flanking nucleotides: gtaga ATGAATTTAAATTCGT tttaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: aroP_pdhR_IR1     Overlap: 1
Solution location in genomic coordinates: 121815-121830
Solution sequence with flanking nucleotides: tttaa TTGAATTAAAAATCAC aaaat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: aroP_pdhR_IR1     Overlap: 11

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 17.86
Model logo: pdhR.3.model.LGO.gif
Sequence logo: pdhR.3.LGO.gif
Sequence Alignment: pdhR.3.ALGN
Solution location in genomic coordinates: 121921-121942
Solution sequence with flanking nucleotides: tgtgc ATAGTTACAACTTTGAAACGTT atata
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 122006-122027
Solution sequence with flanking nucleotides: gacat AAGGTGAATACTTTGTTACTTT agcgt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page