perR Gene Page

Genbank name: perR
EcoGene name: perR
Divergent gene: yi91a
Species with an ortholog: EC SP VC
EcoGene link: EG13340

Species that contributed to the solution: EC VC
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.43
Model logo: perR.1.model.LGO.gif
Sequence logo: perR.1.LGO.gif
Sequence Alignment: perR.1.ALGN
Solution location in genomic coordinates: 269440-269462 R
Solution sequence with flanking nucleotides: ctc TGTTCAGGTGGCCAAATTCAGTA aacca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC VC
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.06
Model logo: perR.2.model.LGO.gif
Sequence logo: perR.2.LGO.gif
Sequence Alignment: perR.2.ALGN
Solution location in genomic coordinates: 269417-269432 R
Solution sequence with flanking nucleotides: ccact TCATCCCTAGTGAAAA ggatt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page