pheA Gene Page
Genbank name: pheA
EcoGene name: pheA
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10707
Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 33.87
Model logo: pheA.1.model.LGO.gif
Sequence logo: pheA.1.LGO.gif
Sequence Alignment: pheA.1.ALGN
Solution location in genomic coordinates: 2735655-2735678
Solution sequence with flanking nucleotides: ttttt ACCTTCCCCTGAATGGGAGGCGTT tcgtc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2735714-2735737
Solution sequence with flanking nucleotides: caata AGGCCTCCCAAATCGGGGGGCCTT tttta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: pheL_pheA_IR     Overlap: 24
Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 13
Number of E. coli sites in the solution: 2
Map value: 23.01
Model logo: pheA.2.model.LGO.gif
Sequence logo: pheA.2.LGO.gif
Sequence Alignment: pheA.2.ALGN
Solution location in genomic coordinates: 2735480-2735503
Solution sequence with flanking nucleotides: tgaaa GACGCCAACTTCGTCGAAGAAGTT gaaga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2735655-2735678
Solution sequence with flanking nucleotides: ttttt ACCTTCCCCTGAATGGGAGGCGTT tcgtc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 16.89
Model logo: pheA.3.model.LGO.gif
Sequence logo: pheA.3.LGO.gif
Sequence Alignment: pheA.3.ALGN
Solution location in genomic coordinates: 2735539-2735558
Solution sequence with flanking nucleotides: tcgcc AACGCGCCTTCGGGCGCGTT ttttg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: TERM44     Overlap: 20
Gene Index Page