pldB Gene Page

Genbank name: pldB
EcoGene name: pldB
Divergent gene: rhtB
Species with an ortholog: EC   HI   ST   VC   YP   
EcoGene link: EG10739

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 16.82
Model logo: pldB.1.model.LGO.gif
Sequence logo: pldB.1.LGO.gif
Sequence Alignment: pldB.1.ALGN
Solution location in genomic coordinates: 4006592-4006614
Solution sequence with flanking nucleotides: tgttg ATTGCACCAGAGCCTGGCGACAG gctta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 16.50
Model logo: pldB.2.model.LGO.gif
Sequence logo: pldB.2.LGO.gif
Sequence Alignment: pldB.2.ALGN
Solution location in genomic coordinates: 4006687-4006703
Solution sequence with flanking nucleotides: gtcta TTTTTGTGCCACAATAC gctac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.55
Model logo: pldB.3.model.LGO.gif
Sequence logo: pldB.3.LGO.gif
Sequence Alignment: pldB.3.ALGN
Solution location in genomic coordinates: 4006647-4006665
Solution sequence with flanking nucleotides: ggcaa ACCACCATTCTAAGGTCAT gatga
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page