pmbA Gene Page

Genbank name: pmbA
EcoGene name: pmbA
Divergent gene: yjgA
Species with an ortholog: AA   EC   HI   SP   ST   TF   VC   YP   
EcoGene link: EG10741

Species that contributed to the solution: AA EC HI ST TF YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 32.81
Model logo: pmbA.1.model.LGO.gif
Sequence logo: pmbA.1.LGO.gif
Sequence Alignment: pmbA.1.ALGN
Solution location in genomic coordinates: 4455451-4455473
Solution sequence with flanking nucleotides: ctcct TAAAAAAAGAGGCTAATGTTACC agtta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST TF VC YP
Total number of sites in the solution: 12
Number of E. coli sites in the solution: 2
Map value: 25.13
Model logo: pmbA.2.model.LGO.gif
Sequence logo: pmbA.2.LGO.gif
Sequence Alignment: pmbA.2.ALGN
Solution location in genomic coordinates: 4455451-4455474
Solution sequence with flanking nucleotides: ctcct TAAAAAAAGAGGCTAATGTTACCA gttaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4455504-4455527
Solution sequence with flanking nucleotides: ttctc TGTTAGACTTCAGAGAAACTCTCT acatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 21.20
Model logo: pmbA.3.model.LGO.gif
Sequence logo: pmbA.3.LGO.gif
Sequence Alignment: pmbA.3.ALGN
Solution location in genomic coordinates: 4455441-4455464
Solution sequence with flanking nucleotides: c TCAGGCTCCTTAAAAAAAGAGGCT aatgt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4455479-4455502
Solution sequence with flanking nucleotides: agtta AGATGCGCACTGAAAAACGGTTCT ctgtt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page