pncB Gene Page
Genbank name: pncB
EcoGene name: pncB
Divergent gene: pepN
Species with an ortholog:
EC PA ST VC YP
EcoGene link: EG10742
Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 10.70
Model logo: pncB.1.model.LGO.gif
Sequence logo: pncB.1.LGO.gif
Sequence Alignment: pncB.1.ALGN
Solution location in genomic coordinates: 989724-989745 R
Solution sequence with flanking nucleotides: acgcc TTTATTGCTACATTTTTATAAC ataca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 989663-989684 R
Solution sequence with flanking nucleotides: catat GGTGTGATCGGGGTTCAATAAA ttgcg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.59
Model logo: pncB.2.model.LGO.gif
Sequence logo: pncB.2.LGO.gif
Sequence Alignment: pncB.2.ALGN
Solution location in genomic coordinates: 989609-989626 R
Solution sequence with flanking nucleotides: gaaga TGTTTATTGTACTAAACG ctcct
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 10.13
Model logo: pncB.3.model.LGO.gif
Sequence logo: pncB.3.LGO.gif
Sequence Alignment: pncB.3.ALGN
Solution location in genomic coordinates: 989643-989660 R
Solution sequence with flanking nucleotides: aaatt GCGAAACAAGGTATACTC cagca
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page