pntA Gene Page
Genbank name: pntA
EcoGene name: pntA
Divergent gene: ydgH
Species with an ortholog:
AA EC HI PA SP ST VC YP
EcoGene link: EG10744
Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 18.34
Model logo: pntA.1.model.LGO.gif
Sequence logo: pntA.1.LGO.gif
Sequence Alignment: pntA.1.ALGN
Solution location in genomic coordinates: 1676232-1676249 R
Solution sequence with flanking nucleotides: ctgaa TTGTATAAGTTAATTTAA tgtta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1676017-1676034 R
Solution sequence with flanking nucleotides: cgttt GTTACTAATTTATTTTAA cggag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 18.12
Model logo: pntA.2.model.LGO.gif
Sequence logo: pntA.2.LGO.gif
Sequence Alignment: pntA.2.ALGN
Solution location in genomic coordinates: 1676371-1676387 R
Solution sequence with flanking nucleotides: tggct GATTATTGCATTTAAAC ggtgt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1676235-1676251 R
Solution sequence with flanking nucleotides: aactg AATTGTATAAGTTAATT taatg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 8.02
Model logo: pntA.3.model.LGO.gif
Sequence logo: pntA.3.LGO.gif
Sequence Alignment: pntA.3.ALGN
Solution location in genomic coordinates: 1676067-1676088 R
Solution sequence with flanking nucleotides: aaata CTGATTTTTGGCGCTAGATCAC aggca
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page