proV Gene Page

Genbank name: proV
EcoGene name: proV
Divergent gene:
Species with an ortholog: EC HI PA ST YP
EcoGene link: EG10771

Species that contributed to the solution: EC HI ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 17.19
Model logo: proV.1.model.LGO.gif
Sequence logo: proV.1.LGO.gif
Sequence Alignment: proV.1.ALGN
Solution location in genomic coordinates: 2802768-2802789
Solution sequence with flanking nucleotides: taggg TAGAAAAAAGTGACTATTTCCA ttggg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2802810-2802831
Solution sequence with flanking nucleotides: acata GACAAATAAAGGAATCTTTCTA ttgc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 16.28
Model logo: proV.2.model.LGO.gif
Sequence logo: proV.2.LGO.gif
Sequence Alignment: proV.2.ALGN
Solution location in genomic coordinates: 2802745-2802765
Solution sequence with flanking nucleotides: gttgc CTCAGATTCTCAGTATGTTAG ggtag
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 13.52
Model logo: proV.3.model.LGO.gif
Sequence logo: proV.3.LGO.gif
Sequence Alignment: proV.3.ALGN
Solution location in genomic coordinates: 2802623-2802644
Solution sequence with flanking nucleotides: ggcgt TTTTTCGCTATCTTTGACAAAA aatat
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page