pta Gene Page

Genbank name: pta
EcoGene name: pta
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   VC   YP   
EcoGene link: EG20173

Species that contributed to the solution: AA EC HI PA ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 25.26
Model logo: pta.1.model.LGO.gif
Sequence logo: pta.1.LGO.gif
Sequence Alignment: pta.1.ALGN
Solution location in genomic coordinates: 2412699-2412719
Solution sequence with flanking nucleotides: ttcac ACCGCCAGCTCAGCTGGCGGT gctgt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ackA_pta_IR     Overlap: 21
Solution location in genomic coordinates: 2412728-2412748
Solution sequence with flanking nucleotides: gtttt GTAACCCGCCAAATCGGCGGT aacga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 9.62
Model logo: pta.2.model.LGO.gif
Sequence logo: pta.2.LGO.gif
Sequence Alignment: pta.2.ALGN
Solution location in genomic coordinates: 2412749-2412765
Solution sequence with flanking nucleotides: gcggt AACGAAAGAGGATAAAC c
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 9.51
Model logo: pta.3.model.LGO.gif
Sequence logo: pta.3.LGO.gif
Sequence Alignment: pta.3.ALGN
Solution location in genomic coordinates: 2412714-2412737
Solution sequence with flanking nucleotides: cagct GGCGGTGCTGTTTTGTAACCCGCC aaatc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ackA_pta_IR     Overlap: 7


Gene Index Page