purA Gene Page

Genbank name: purA
EcoGene name: purA
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10790
   Reported site,genomic coordinates and site type: DPInteract 4402139:4402164 purR
   Reported site,genomic coordinates and site type: DPInteract 4402238:4402263 purR

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 35.97
Model logo: purA.1.model.LGO.gif
Sequence logo: purA.1.LGO.gif
Sequence Alignment: purA.1.ALGN
Solution location in genomic coordinates: 4402226-4402247
Solution sequence with flanking nucleotides: agcga TGGTAGAATCCATTTTTAAGCA aacgg
Number of overlapping basepairs with reported site: 10
Site type: purR

Species that contributed to the solution: AA EC HI SP ST TF VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 28.73
Model logo: purA.2.model.LGO.gif
Sequence logo: purA.2.LGO.gif
Sequence Alignment: purA.2.ALGN
Solution location in genomic coordinates: 4402193-4402215
Solution sequence with flanking nucleotides: ttttg AGTGCAAAAAGTGCTGTAACTCT gaaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4402224-4402246
Solution sequence with flanking nucleotides: aaagc GATGGTAGAATCCATTTTTAAGC aaacg
Number of overlapping basepairs with reported site: 9
Site type: purR

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.54
Model logo: purA.3.model.LGO.gif
Sequence logo: purA.3.LGO.gif
Sequence Alignment: purA.3.ALGN
Solution location in genomic coordinates: 4402206-4402224
Solution sequence with flanking nucleotides: aagtg CTGTAACTCTGAAAAAGCG atggt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page