putA Gene Page
Genbank name: putA
EcoGene name: putA
Divergent gene: putP
Species with an ortholog:
EC ST YP
EcoGene link: EG10801
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 28.70
Model logo: putA.1.model.LGO.gif
Sequence logo: putA.1.LGO.gif
Sequence Alignment: putA.1.ALGN
Solution location in genomic coordinates: 1078324-1078347 R
Solution sequence with flanking nucleotides: tattt TTCATCAGGTTGCACTCTCTCACA ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1078157-1078180 R
Solution sequence with flanking nucleotides: atggt TGCACAAAGTTGCAACATCATGGA tattt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 22.82
Model logo: putA.2.model.LGO.gif
Sequence logo: putA.2.LGO.gif
Sequence Alignment: putA.2.ALGN
Solution location in genomic coordinates: 1078157-1078180 R
Solution sequence with flanking nucleotides: atggt TGCACAAAGTTGCAACATCATGGA tattt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1078122-1078145 R
Solution sequence with flanking nucleotides: acgat AACGTTAAGTTGCACCTTTCTGAA caaca
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 16.14
Model logo: putA.3.model.LGO.gif
Sequence logo: putA.3.LGO.gif
Sequence Alignment: putA.3.ALGN
Solution location in genomic coordinates: 1078292-1078313 R
Solution sequence with flanking nucleotides: tgcgg TTGCACCTTTCAAAAATGTTAA ctgcc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1078211-1078232 R
Solution sequence with flanking nucleotides: tttta TTAACATTTCATTCATTTTTAA gcttg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page