putP Gene Page
Genbank name: putP
EcoGene name: putP
Divergent gene: putA
Species with an ortholog:
AA EC HI PA SP ST VC YP
EcoGene link: EG10802
Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 14.31
Model logo: putP.1.model.LGO.gif
Sequence logo: putP.1.LGO.gif
Sequence Alignment: putP.1.ALGN
Solution location in genomic coordinates: 1078152-1078175
Solution sequence with flanking nucleotides: tcgtg AAATATCCATGATGTTGCAACTTT gtgca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1078189-1078212
Solution sequence with flanking nucleotides: atgtt AAATGTGACATGCGTAGCAAGCTT aaaaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 13.49
Model logo: putP.2.model.LGO.gif
Sequence logo: putP.2.LGO.gif
Sequence Alignment: putP.2.ALGN
Solution location in genomic coordinates: 1078372-1078395
Solution sequence with flanking nucleotides: taaaa TTTAATGTAAATGGTGTGTTAAAT cgatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1078488-1078511
Solution sequence with flanking nucleotides: cggca AGTTTCGACATTGCCGATAATAAT ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 13.29
Model logo: putP.3.model.LGO.gif
Sequence logo: putP.3.LGO.gif
Sequence Alignment: putP.3.ALGN
Solution location in genomic coordinates: 1078149-1078171
Solution sequence with flanking nucleotides: ttatc GTGAAATATCCATGATGTTGCAA ctttg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1078440-1078462
Solution sequence with flanking nucleotides: ccctg GTAAAACATAAACTCTGTTACCC cgttc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page