rnb Gene Page

Genbank name: rnb
EcoGene name: rnb
Divergent gene:
Species with an ortholog: AA EC HI ST VC YP
EcoGene link: EG11620

Species that contributed to the solution: AA EC HI ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 18.10
Model logo: rnb.1.model.LGO.gif
Sequence logo: rnb.1.LGO.gif
Sequence Alignment: rnb.1.ALGN
Solution location in genomic coordinates: 1346971-1346988 R
Solution sequence with flanking nucleotides: tcaga CAGATTCGCGTAAAACTG tcagc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 11.80
Model logo: rnb.2.model.LGO.gif
Sequence logo: rnb.2.LGO.gif
Sequence Alignment: rnb.2.ALGN
Solution location in genomic coordinates: 1346942-1346962 R
Solution sequence with flanking nucleotides: gccgc TCTAATGGCCACCAAAATAGA caatt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page