rplM Gene Page
Genbank name: rplM
EcoGene name: rplM
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10874
Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 26.98
Model logo: rplM.1.model.LGO.gif
Sequence logo: rplM.1.LGO.gif
Sequence Alignment: rplM.1.ALGN
Solution location in genomic coordinates: 3376376-3376391 R
Solution sequence with flanking nucleotides: gcata GGCTATTCGAAGGGGT aggtt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 21.24
Model logo: rplM.2.model.LGO.gif
Sequence logo: rplM.2.LGO.gif
Sequence Alignment: rplM.2.ALGN
Solution location in genomic coordinates: 3376433-3376453 R
Solution sequence with flanking nucleotides: ctcta TAATCCTGCGACCCCACGTTA caaga
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 20.71
Model logo: rplM.3.model.LGO.gif
Sequence logo: rplM.3.LGO.gif
Sequence Alignment: rplM.3.ALGN
Solution location in genomic coordinates: 3376468-3376489 R
Solution sequence with flanking nucleotides: aaatc ACAAAAAGGGGTCGATCTTTGA ccccg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page