rpsF Gene Page
Genbank name: rpsF
EcoGene name: rpsF
Divergent gene: yjfY
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10905
Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 1
Map value: 46.76
Model logo: rpsF.1.model.LGO.gif
Sequence logo: rpsF.1.LGO.gif
Sequence Alignment: rpsF.1.ALGN
Solution location in genomic coordinates: 4422673-4422692
Solution sequence with flanking nucleotides: ggctg AATAATCCGTAAGGAGCAAT tcg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST TF VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 29.39
Model logo: rpsF.2.model.LGO.gif
Sequence logo: rpsF.2.LGO.gif
Sequence Alignment: rpsF.2.ALGN
Solution location in genomic coordinates: 4422590-4422613
Solution sequence with flanking nucleotides: ataca AGTACTATAACGCGTCATTTTTCA gccga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4422616-4422639
Solution sequence with flanking nucleotides: tcagc CGACCTTTAACACGTTCCTTGCCT ccccg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 15.31
Model logo: rpsF.3.model.LGO.gif
Sequence logo: rpsF.3.LGO.gif
Sequence Alignment: rpsF.3.ALGN
Solution location in genomic coordinates: 4422650-4422671
Solution sequence with flanking nucleotides: ggatt CGGCTGACCCAGACAGGAGGCT gaata
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page