rpsG Gene Page

Genbank name: rpsG
EcoGene name: rpsG
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10906

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 13
Number of E. coli sites in the solution: 2
Map value: 66.76
Model logo: rpsG.1.model.LGO.gif
Sequence logo: rpsG.1.LGO.gif
Sequence Alignment: rpsG.1.ALGN
Solution location in genomic coordinates: 3471784-3471805 R
Solution sequence with flanking nucleotides: tctcc GTTAAGTAAGGCCAAACGTTTT aactt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3471738-3471759 R
Solution sequence with flanking nucleotides: actcg TAGAGTTTTGGACAATCCTGAA ttaac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 37.12
Model logo: rpsG.2.model.LGO.gif
Sequence logo: rpsG.2.LGO.gif
Sequence Alignment: rpsG.2.ALGN
Solution location in genomic coordinates: 3471720-3471736 R
Solution sequence with flanking nucleotides: tgaat TAACAACGGAGTATTTC c
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 33.60
Model logo: rpsG.3.model.LGO.gif
Sequence logo: rpsG.3.LGO.gif
Sequence Alignment: rpsG.3.ALGN
Solution location in genomic coordinates: 3471762-3471782 R
Solution sequence with flanking nucleotides: tttta ACTTAAATGTCAAACTAAACT cgtag
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page