rpsM Gene Page

Genbank name: rpsM
EcoGene name: rpsM
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10912

Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 67.48
Model logo: rpsM.1.model.LGO.gif
Sequence logo: rpsM.1.LGO.gif
Sequence Alignment: rpsM.1.ALGN
Solution location in genomic coordinates: 3440324-3440346 R
Solution sequence with flanking nucleotides: caaga AATTATGCCGTAACTGCAAAATC gttaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 16
Number of E. coli sites in the solution: 2
Map value: 59.38
Model logo: rpsM.2.model.LGO.gif
Sequence logo: rpsM.2.LGO.gif
Sequence Alignment: rpsM.2.ALGN
Solution location in genomic coordinates: 3440473-3440494 R
Solution sequence with flanking nucleotides: gatta TGGACTTTATGGCTCAAGTGCA aactc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3440349-3440370 R
Solution sequence with flanking nucleotides: aaaaa TGAAAGTTCGTGCTTCCGTCAA gaaat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 12
Number of E. coli sites in the solution: 2
Map value: 55.98
Model logo: rpsM.3.model.LGO.gif
Sequence logo: rpsM.3.LGO.gif
Sequence Alignment: rpsM.3.ALGN
Solution location in genomic coordinates: 3440533-3440552 R
Solution sequence with flanking nucleotides: atgca ATGAAAGTACCGTTCTACTT cggtg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3440352-3440371 R
Solution sequence with flanking nucleotides: taaaa ATGAAAGTTCGTGCTTCCGT caaga
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page