rpsO Gene Page

Genbank name: rpsO
EcoGene name: rpsO
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10914

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 43.70
Model logo: rpsO.1.model.LGO.gif
Sequence logo: rpsO.1.LGO.gif
Sequence Alignment: rpsO.1.ALGN
Solution location in genomic coordinates: 3309359-3309376 R
Solution sequence with flanking nucleotides: ggatc GCTGAATTAGAGATCGGC gtcct
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 20.60
Model logo: rpsO.2.model.LGO.gif
Sequence logo: rpsO.2.LGO.gif
Sequence Alignment: rpsO.2.ALGN
Solution location in genomic coordinates: 3309408-3309428 R
Solution sequence with flanking nucleotides: actgc CGCTTAACGTCGCGTAAATTG tttaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3309382-3309402 R
Solution sequence with flanking nucleotides: tttaa CACTTTGCGTAACGTACACTG ggatc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 12.28
Model logo: rpsO.3.model.LGO.gif
Sequence logo: rpsO.3.LGO.gif
Sequence Alignment: rpsO.3.ALGN
Solution location in genomic coordinates: 3309330-3309346 R
Solution sequence with flanking nucleotides: cattc TATATACTTTGGAGTTT taaa
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page