sdhC Gene Page

Solution location in genomic coordinates: 754128-754147
Solution sequence with flanking nucleotides: acaaa CTATATGTAGGTTAATTGTA atgat
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 17.79
Model logo: sdhC.2.model.LGO.gif
Sequence logo: sdhC.2.LGO.gif
Sequence Alignment: sdhC.2.ALGN
Solution location in genomic coordinates: 754039-754059
Solution sequence with flanking nucleotides: aactt TGTTGAATGATTGTCAAATTA gatga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 754062-754082
Solution sequence with flanking nucleotides: ttaga TGATTAAAAATTAAATAAATG ttgtt
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 15.76
Model logo: sdhC.3.model.LGO.gif
Sequence logo: sdhC.3.LGO.gif
Sequence Alignment: sdhC.3.ALGN
Solution location in genomic coordinates: 754117-754139
Solution sequence with flanking nucleotides: gataa AACCCGACAAACTATATGTAGGT taatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 754159-754181
Solution sequence with flanking nucleotides: ttgtg AACAGCCTATACTGCCGCCAGGT ctccg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page