sgcC Gene Page

Solution location in genomic coordinates: 4527839-4527861 R
Solution sequence with flanking nucleotides: acgac GCGTTAAAACAACAAATCAAGGC tctgt
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 10.52
Model logo: sgcC.2.model.LGO.gif
Sequence logo: sgcC.2.LGO.gif
Sequence Alignment: sgcC.2.ALGN
Solution location in genomic coordinates: 4528060-4528080 R
Solution sequence with flanking nucleotides: tggca TGCGGTACCGGCATGTCGACT tcaac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4527901-4527921 R
Solution sequence with flanking nucleotides: ccaac AGTGATTACGGCATCCCTACG cttaa
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 10.51
Model logo: sgcC.3.model.LGO.gif
Sequence logo: sgcC.3.LGO.gif
Sequence Alignment: sgcC.3.ALGN
Solution location in genomic coordinates: 4528083-4528100 R
Solution sequence with flanking nucleotides: TGAAAAAGATCCTTGTGG catgc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4527966-4527983 R
Solution sequence with flanking nucleotides: ctgtc TGAATGAGATCCCTCTTA actgt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page