slt Gene Page

Genbank name: slt
EcoGene name: slt
Divergent gene: yjjK
Species with an ortholog: EC   SP   ST   VC   YP   
EcoGene link: EG10950

Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 21.78
Model logo: slt.1.model.LGO.gif
Sequence logo: slt.1.LGO.gif
Sequence Alignment: slt.1.ALGN
Solution location in genomic coordinates: 4628133-4628152
Solution sequence with flanking nucleotides: ttttc AAAGGCGAAGTGTAGCCTTT ttccc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4628193-4628212
Solution sequence with flanking nucleotides: cagta AAAGTAAAAAAGTGTCCGTA acgtg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 19.37
Model logo: slt.2.model.LGO.gif
Sequence logo: slt.2.LGO.gif
Sequence Alignment: slt.2.ALGN
Solution location in genomic coordinates: 4628110-4628128
Solution sequence with flanking nucleotides: tctat GTTTATCGTGATAATGAGT tttca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4628254-4628272
Solution sequence with flanking nucleotides: ctatt ACGCGGCATGACGCTGCAT tg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 9.09
Model logo: slt.3.model.LGO.gif
Sequence logo: slt.3.LGO.gif
Sequence Alignment: slt.3.ALGN
Solution location in genomic coordinates: 4628233-4628253
Solution sequence with flanking nucleotides: caatg ACTGGTTAGCATAAATCTATT acgcg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page