smf_1 Gene Page

Genbank name: smf_1
EcoGene name: smf
Divergent gene: def
Species with an ortholog: AA EC HI ST YP
EcoGene link: EG11604

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 20.35
Model logo: smf_1.1.model.LGO.gif
Sequence logo: smf_1.1.LGO.gif
Sequence Alignment: smf_1.1.ALGN
Solution location in genomic coordinates: 3431302-3431325 R
Solution sequence with flanking nucleotides: a AATCTCCAGAGATGTGTTCAGGAG ttaga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3431260-3431283 R
Solution sequence with flanking nucleotides: ttctt CTATTCTAGACAAATCCCCCTCTG attga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 18.30
Model logo: smf_1.2.model.LGO.gif
Sequence logo: smf_1.2.LGO.gif
Sequence Alignment: smf_1.2.ALGN
Solution location in genomic coordinates: 3431225-3431243 R
Solution sequence with flanking nucleotides: cactg ACCAATCGCAAAGATTGCT aaggc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.15
Model logo: smf_1.3.model.LGO.gif
Sequence logo: smf_1.3.LGO.gif
Sequence Alignment: smf_1.3.ALGN
Solution location in genomic coordinates: 3431284-3431300 R
Solution sequence with flanking nucleotides: ggagt TAGAAAGATTATTTCTT ctatt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page