smpB Gene Page

Genbank name: smpB
EcoGene name: smpB
Divergent gene: yfjG
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG11782

Species that contributed to the solution: AA EC HI SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 5.94
Model logo: smpB.1.model.LGO.gif
Sequence logo: smpB.1.LGO.gif
Sequence Alignment: smpB.1.ALGN
Solution location in genomic coordinates: 2752881-2752896
Solution sequence with flanking nucleotides: gggtg TTTTCGATTTCAGATT accga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST TF YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 5.92
Model logo: smpB.2.model.LGO.gif
Sequence logo: smpB.2.LGO.gif
Sequence Alignment: smpB.2.ALGN
Solution location in genomic coordinates: 2752832-2752852
Solution sequence with flanking nucleotides: catcg GGTTCATGCTAAGATAGAGCC ttgtc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC PA ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 4.67
Model logo: smpB.3.model.LGO.gif
Sequence logo: smpB.3.LGO.gif
Sequence Alignment: smpB.3.ALGN
Solution location in genomic coordinates: 2752857-2752880
Solution sequence with flanking nucleotides: cttgt CCCCCGCAGGATTGATATGGGGTG ttttc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page