sodA Gene Page

Genbank name: sodA
EcoGene name: sodA
Divergent gene: rhaT
Species with an ortholog: EC   HI   PA   ST   VC   YP   
EcoGene link: EG10953
   Reported site,genomic coordinates and site type: DPInteract 4098313:4098327 arcA
   Reported site,genomic coordinates and site type: DPInteract 4098292:4098309 fur
   Reported site,genomic coordinates and site type: DPInteract 4098320:4098337 fur
   Reported site,genomic coordinates and site type: DPInteract 4098286:4098320 soxS
   Reported site,genomic coordinates and site type: DPInteract 4098248:4098282 soxS

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 23.78
Model logo: sodA.1.model.LGO.gif
Sequence logo: sodA.1.LGO.gif
Sequence Alignment: sodA.1.ALGN
Solution location in genomic coordinates: 4098300-4098320
Solution sequence with flanking nucleotides: attga TAATCATTTTCAATATCATTT aatta
Number of overlapping basepairs with reported site: 21
Site type: arcA fur fur soxS

Species that contributed to the solution: EC HI VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 16.12
Model logo: sodA.2.model.LGO.gif
Sequence logo: sodA.2.LGO.gif
Sequence Alignment: sodA.2.ALGN
Solution location in genomic coordinates: 4098297-4098320
Solution sequence with flanking nucleotides: ggcat TGATAATCATTTTCAATATCATTT aatta
Number of overlapping basepairs with reported site: 24
Site type: arcA fur fur soxS
Solution location in genomic coordinates: 4098324-4098347
Solution sequence with flanking nucleotides: ttaat TAACTATAATGAACCAACTGCTTA cgcgg
Number of overlapping basepairs with reported site: 14
Site type: arcA fur

Species that contributed to the solution: EC PA ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 5.75
Model logo: sodA.3.model.LGO.gif
Sequence logo: sodA.3.LGO.gif
Sequence Alignment: sodA.3.ALGN
Solution location in genomic coordinates: 4098191-4098206
Solution sequence with flanking nucleotides: gcctg TTGCCGCCGTTGTCGA tttac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4098370-4098385
Solution sequence with flanking nucleotides: gccgc CCGACAATACTGGAGA tgaat
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page