speF Gene Page

Genbank name: speF
EcoGene name: speF
Divergent gene:
Species with an ortholog: EC HI SP ST VC YP
EcoGene link: EG10964

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 13.82
Model logo: speF.1.model.LGO.gif
Sequence logo: speF.1.LGO.gif
Sequence Alignment: speF.1.ALGN
Solution location in genomic coordinates: 720122-720145 R
Solution sequence with flanking nucleotides: aaata AATTAAGATTGATCATTTTTTATT gatca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 719777-719800 R
Solution sequence with flanking nucleotides: tctga AAAAAGCAATCTACCTGATTTATT tatca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: speF_ybfK_IR Overlap: 24

Species that contributed to the solution: EC HI SP VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 9.70
Model logo: speF.2.model.LGO.gif
Sequence logo: speF.2.LGO.gif
Sequence Alignment: speF.2.ALGN
Solution location in genomic coordinates: 719718-719741 R
Solution sequence with flanking nucleotides: cacga TCGATTTCTCATTCGAGAAATTGA ggacc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 9.46
Model logo: speF.3.model.LGO.gif
Sequence logo: speF.3.LGO.gif
Sequence Alignment: speF.3.ALGN
Solution location in genomic coordinates: 719693-719712 R
Solution sequence with flanking nucleotides: ggacc TGCTATTACCTAAAATAAAG agatg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page