sucC Gene Page

Genbank name: sucC
EcoGene name: sucC
Divergent gene:
Species with an ortholog: EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10981
Species that contributed to the solution: EC HI PA ST TF
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 17.73
Model logo: sucC.1.model.LGO.gif
Sequence logo: sucC.1.LGO.gif
Sequence Alignment: sucC.1.ALGN
Solution location in genomic coordinates: 761992-762015
Solution sequence with flanking nucleotides: agacc GGATAAGGCATTATCGCCTTCTCC ggcaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP68a     Overlap: 24
Solution location in genomic coordinates: 762081-762104
Solution sequence with flanking nucleotides: aggtc GGATAAGGCGCAAGCGCCGCATCC gacaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP68c     Overlap: 24
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 9.99
Model logo: sucC.2.model.LGO.gif
Sequence logo: sucC.2.LGO.gif
Sequence Alignment: sucC.2.ALGN
Solution location in genomic coordinates: 762049-762064
Solution sequence with flanking nucleotides: gcgtc TTATCAGGCCTACGGG accac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP68b     Overlap: 13
Solution location in genomic coordinates: 762139-762154
Solution sequence with flanking nucleotides: gtgtc TTATCAGGCCTACGGG tgacc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP68d     Overlap: 13
Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 8.09
Model logo: sucC.3.model.LGO.gif
Sequence logo: sucC.3.LGO.gif
Sequence Alignment: sucC.3.ALGN
Solution location in genomic coordinates: 762022-762041
Solution sequence with flanking nucleotides: gcaat TGAAGCCTGATGCGACGCTG acgcg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP68b     Overlap: 16
Solution location in genomic coordinates: 762111-762130
Solution sequence with flanking nucleotides: acaag CGATGCCTGATGTGACGTTT aacgt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP68d     Overlap: 16


Gene Index Page