tdcA Gene Page
Genbank name: tdcA
EcoGene name: tdcA
Divergent gene: tdcR
Species with an ortholog:
EC ST
EcoGene link: EG10989
Reported site,genomic coordinates and site type: DPInteract 3264767:3264788 crp
Reported site,genomic coordinates and site type: DPInteract 3264818:3264865 ihf
Reported site,genomic coordinates and site type: DPInteract 3264814:3264861 ihf
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.94
Model logo: tdcA.1.model.LGO.gif
Sequence logo: tdcA.1.LGO.gif
Sequence Alignment: tdcA.1.ALGN
Solution location in genomic coordinates: 3264769-3264788 R
Solution sequence with flanking nucleotides: agtta ATTTGTGAGTGGTCGCACAT atcct
Number of overlapping basepairs with reported site: 20
Site type: crp
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.90
Model logo: tdcA.2.model.LGO.gif
Sequence logo: tdcA.2.LGO.gif
Sequence Alignment: tdcA.2.ALGN
Solution location in genomic coordinates: 3264715-3264736 R
Solution sequence with flanking nucleotides: tcatg CCGTCAATGAGGTAATTAACGT aggtc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 5.73
Model logo: tdcA.3.model.LGO.gif
Sequence logo: tdcA.3.LGO.gif
Sequence Alignment: tdcA.3.ALGN
Solution location in genomic coordinates: 3264816-3264832 R
Solution sequence with flanking nucleotides: taaag GTATTTAATTGTAATAA cgata
Number of overlapping basepairs with reported site: 17
Site type: ihf ihf
Repeat: tdcA_tdcR_IR     Overlap: 17
Solution location in genomic coordinates: 3264745-3264761 R
Solution sequence with flanking nucleotides: cctgt TCATTTCATTTTGATAC acttc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page