tdk Gene Page

Genbank name: tdk
EcoGene name: tdk
Divergent gene: hns
Species with an ortholog: AA   EC   HI   SP   ST   VC   YP   
EcoGene link: EG10994

Species that contributed to the solution: EC HI YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 8.35
Model logo: tdk.1.model.LGO.gif
Sequence logo: tdk.1.LGO.gif
Sequence Alignment: tdk.1.ALGN
Solution location in genomic coordinates: 1292694-1292710
Solution sequence with flanking nucleotides: actga CGAATTATGATAAACTC cagcc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 6.93
Model logo: tdk.2.model.LGO.gif
Sequence logo: tdk.2.LGO.gif
Sequence Alignment: tdk.2.ALGN
Solution location in genomic coordinates: 1292276-1292296
Solution sequence with flanking nucleotides: tatct TTTCATAAAATTAGCCAGAAA agacg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1292428-1292448
Solution sequence with flanking nucleotides: ttgtg TTTACGAGAATTCCCTATTAA gcgaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 6.90
Model logo: tdk.3.model.LGO.gif
Sequence logo: tdk.3.LGO.gif
Sequence Alignment: tdk.3.ALGN
Solution location in genomic coordinates: 1292573-1292592
Solution sequence with flanking nucleotides: agcag TCATTTACCCGCTTATAACA agcga
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page